MitoKor – Human Mitochondrial Genomes

MITOMAP GOBASE dataset is composed genome sequences analysis of coding DNA

fallback-image

Slamf6 Human Flow Antibody

Lab Reagents

Human Antibody Laboratories manufactures the slamf6 human flow antibody reagents distributed by Genprice. The Slamf6 Human Flow Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact human Antibody. Other Slamf6 products are available in stock. Specificity: Slamf6 Category: Human Group: Flow Antibody

Flow Antibody information

SLAMF6 Polyclonal Conjugated Antibody

C27384 100ul
EUR 397

SLAMF6 Antibody, HRP conjugated

1-CSB-PA021368LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLAMF6 Antibody, FITC conjugated

1-CSB-PA021368LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLAMF6 Antibody, Biotin conjugated

1-CSB-PA021368LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SLAMF6 shRNA Plasmid

20-abx964397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLAMF6 Human Recombinant Protein

PROTQ96DU3 Regular: 20ug
EUR 317
Description: SLAMF6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 228 amino acids (22-226 a.a.) and having a molecular mass of 25.5kDa. SLAMF6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SLAMF6 Recombinant Protein (Human)

RP097032 100 ug Ask for price

SLAMF6 Rabbit pAb

A10338-100ul 100 ul
EUR 308

SLAMF6 Rabbit pAb

A10338-200ul 200 ul
EUR 459

SLAMF6 Rabbit pAb

A10338-20ul 20 ul
EUR 183

SLAMF6 Rabbit pAb

A10338-50ul 50 ul
EUR 223

SLAMF6 Blocking Peptide

33R-2470 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7225

SLAMF6 Blocking Peptide

33R-6685 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7224

SLAMF6 cloning plasmid

CSB-CL021368HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 999
  • Sequence: ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGGAATGTAGTTTCACAAAGCAGCTTAACCCCATTGATGGTGAACGGGATTCTGGGGGAGTCAGTAACTCTTCCCCTGGAGTTTCCTGCAGGAGAGAAGGTCAACTTCATCACTTGGCTTTTCAATGA
  • Show more
Description: A cloning plasmid for the SLAMF6 gene.

Polyclonal SLAMF6 Antibody (C-term)

APR04066G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLAMF6 (C-term). This antibody is tested and proven to work in the following applications:

SLAMF6 Polyclonal Antibody, HRP Conjugated

A69700 100 ?g
EUR 628.55
Description: The best epigenetics products

SLAMF6 Polyclonal Antibody, FITC Conjugated

A69701 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Recent Posts

Categories

January 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Tags

Bahçeşehir escort Beylikdüzü escort tesettürlü escort travesti escort nattsumi.com blackmoth.org filme porno abatı escort