Lab Reagents

Human Antibody Laboratories manufactures the slamf6 human flow antibody reagents distributed by Genprice. The Slamf6 Human Flow Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact human Antibody. Other Slamf6 products are available in stock. Specificity: Slamf6 Category: Human Group: Flow Antibody

Flow Antibody information

SLAMF6 Polyclonal Conjugated Antibody
C27384	SAB	100ul	EUR 397

SLAMF6 Antibody, HRP conjugated
1-CSB-PA021368LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLAMF6 Antibody, FITC conjugated
1-CSB-PA021368LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLAMF6 Antibody, Biotin conjugated
1-CSB-PA021368LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SLAMF6 shRNA Plasmid
20-abx964397	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SLAMF6 Human Recombinant Protein
PROTQ96DU3	BosterBio	Regular: 20ug	EUR 317
Description: SLAMF6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 228 amino acids (22-226 a.a.) and having a molecular mass of 25.5kDa. SLAMF6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SLAMF6 Recombinant Protein (Human)
RP097032	ABM	100 ug	Ask for price

SLAMF6 Rabbit pAb
A10338-100ul	Abclonal	100 ul	EUR 308

SLAMF6 Rabbit pAb
A10338-200ul	Abclonal	200 ul	EUR 459

SLAMF6 Rabbit pAb
A10338-20ul	Abclonal	20 ul	EUR 183

SLAMF6 Rabbit pAb
A10338-50ul	Abclonal	50 ul	EUR 223

SLAMF6 Blocking Peptide
33R-2470	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7225

SLAMF6 Blocking Peptide
33R-6685	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7224

SLAMF6 cloning plasmid
CSB-CL021368HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 999 Sequence: ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGGAATGTAGTTTCACAAAGCAGCTTAACCCCATTGATGGTGAACGGGATTCTGGGGGAGTCAGTAACTCTTCCCCTGGAGTTTCCTGCAGGAGAGAAGGTCAACTTCATCACTTGGCTTTTCAATGA Show more
Description: A cloning plasmid for the SLAMF6 gene.

Polyclonal SLAMF6 Antibody (C-term)
APR04066G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLAMF6 (C-term). This antibody is tested and proven to work in the following applications:

SLAMF6 Polyclonal Antibody, HRP Conjugated
A69700	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

SLAMF6 Polyclonal Antibody, FITC Conjugated
A69701	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research