Lab Reagents
Human Antibody Laboratories manufactures the slamf6 human flow antibody reagents distributed by Genprice. The Slamf6 Human Flow Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact human Antibody. Other Slamf6 products are available in stock. Specificity: Slamf6 Category: Human Group: Flow Antibody
Flow Antibody information
SLAMF6 Polyclonal Conjugated Antibody |
C27384 |
SAB |
100ul |
EUR 397 |
SLAMF6 Antibody, HRP conjugated |
1-CSB-PA021368LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SLAMF6 Antibody, FITC conjugated |
1-CSB-PA021368LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SLAMF6 Antibody, Biotin conjugated |
1-CSB-PA021368LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SLAMF6. Recognizes SLAMF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human SLAMF6 shRNA Plasmid |
20-abx964397 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SLAMF6 Human Recombinant Protein |
PROTQ96DU3 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SLAMF6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 228 amino acids (22-226 a.a.) and having a molecular mass of 25.5kDa. SLAMF6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
SLAMF6 Recombinant Protein (Human) |
RP097032 |
ABM |
100 ug |
Ask for price |
SLAMF6 Rabbit pAb |
A10338-100ul |
Abclonal |
100 ul |
EUR 308 |
SLAMF6 Rabbit pAb |
A10338-200ul |
Abclonal |
200 ul |
EUR 459 |
SLAMF6 Rabbit pAb |
A10338-20ul |
Abclonal |
20 ul |
EUR 183 |
SLAMF6 Rabbit pAb |
A10338-50ul |
Abclonal |
50 ul |
EUR 223 |
SLAMF6 Blocking Peptide |
33R-2470 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7225 |
SLAMF6 Blocking Peptide |
33R-6685 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLAMF6 antibody, catalog no. 70R-7224 |
SLAMF6 cloning plasmid |
CSB-CL021368HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 999
- Sequence: ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGGAATGTAGTTTCACAAAGCAGCTTAACCCCATTGATGGTGAACGGGATTCTGGGGGAGTCAGTAACTCTTCCCCTGGAGTTTCCTGCAGGAGAGAAGGTCAACTTCATCACTTGGCTTTTCAATGA
- Show more
|
Description: A cloning plasmid for the SLAMF6 gene. |
Polyclonal SLAMF6 Antibody (C-term) |
APR04066G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLAMF6 (C-term). This antibody is tested and proven to work in the following applications: |
SLAMF6 Polyclonal Antibody, HRP Conjugated |
A69700 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
SLAMF6 Polyclonal Antibody, FITC Conjugated |
A69701 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |