Mitochondrial p53 prompts Bak and causes disruption of a Bak-Mcl1 advanced.
- The tumour suppressor exercise of the p53 protein has been defined by its means to induce apoptosis in response to quite a lot of mobile stresses.
- Thus, understanding the mechanism by which p53 features within the execution of cell demise pathways is of appreciable significance in most cancers biology.
- Latest research have indicated that p53 has a direct signalling position at mitochondria within the induction of apoptosis, though the mechanisms concerned usually are not utterly understood.
DNA Polymerase for PAGE Enzyme
- Right here we present that, after cell stress, p53 interacts with the pro-apoptotic mitochondrial membrane protein Bak. Interplay of p53 with Bak causes oligomerization of Bak and launch of cytochrome c from mitochondria.
Guanine Nucleotide Exchange Factor For Rab-3A (RAB3IL1) Antibody
- Notably, we present that formation of the p53-Bak advanced coincides with lack of an interplay between Bak and the anti-apoptotic Bcl2-family member Mcl1. These outcomes are in step with a mannequin through which p53 and Mcl1 have opposing results on mitochondrial apoptosis by interacting with, and modulating the exercise of, the demise effector Bak.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Hu-96T |
DL Develop |
96T |
EUR 718 |
- Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids. |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
DLR-vHL-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids. |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RDR-vHL-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit |
RD-vHL-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
VHL Antibody |
AF6292 |
Affbiotech |
200ul |
EUR 304 |
Description: VHL Antibody detects endogenous levels of total VHL. |
VHL antibody |
70R-34605 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal VHL antibody |
VHL antibody |
70R-9757 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VHL antibody |
VHL antibody |
10R-1029 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal VHL antibody |
VHL Antibody |
32075-100ul |
SAB |
100ul |
EUR 252 |
VHL Antibody |
DF6104 |
Affbiotech |
200ul |
EUR 304 |
Description: VHL Antibody detects endogenous levels of total VHL. |
VHL Antibody |
1-CSB-PA991849 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
VHL Antibody |
1-CSB-PA876839 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
VHL Antibody |
1-CSB-PA071125 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
VHL Antibody |
1-CSB-PA060067 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000 |
VHL Antibody |
CSB-PA025852KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
VHL Antibody |
CSB-PA025852KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
VHL Conjugated Antibody |
C32075 |
SAB |
100ul |
EUR 397 |
anti- VHL antibody |
FNab09402 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: IF: 1:10-1:100
- IHC: 1:20-1:200
- Immunogen: von Hippel-Lindau tumor suppressor
- Uniprot ID: P40337
- Gene ID: 7428
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against VHL |
anti- VHL antibody |
FNab10175 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:50-1:500
- Immunogen: Histone-lysine N-methyltransferase EZH2
- Uniprot ID: P40337
- Gene ID: 7428
|
Description: Antibody raised against VHL |
VHL Polyclonal Antibody |
ES7499-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
VHL Polyclonal Antibody |
ES7499-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
VHL Polyclonal Antibody |
ES8746-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA |
VHL Polyclonal Antibody |
ES8746-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA |
VHL Polyclonal Antibody |
ABP60891-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 |
VHL Polyclonal Antibody |
ABP60891-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 |
VHL Polyclonal Antibody |
ABP60891-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 |
VHL Polyclonal Antibody |
ABP56500-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL Polyclonal Antibody |
ABP56500-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL Polyclonal Antibody |
ABP56500-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
- Applications tips:
|
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68 |
VHL (pS68) Antibody |
abx219320-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
VHL Polyclonal Antibody |
46866-100ul |
SAB |
100ul |
EUR 252 |
VHL Polyclonal Antibody |
46866-50ul |
SAB |
50ul |
EUR 187 |
Human VHL Antibody |
32825-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-VHL antibody |
STJ98809 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to VHL. |
Anti-VHL antibody |
STJ96241 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to VHL. |
Anti-VHL antibody |
STJ26089 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
Anti-VHL antibody |
STJ113440 |
St John's Laboratory |
50 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
Anti-VHL antibody |
STJ113742 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
VHL siRNA |
20-abx906024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VHL siRNA |
20-abx939411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VHL siRNA |
20-abx939412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-VHL (Ser68) Antibody |
AF8334 |
Affbiotech |
200ul |
EUR 376 |
Description: VHL (Phospho-Ser68) Antibody detects endogenous levels of VHL only when phosphorylated at Ser68. |
VHL (Phospho-Ser68) Antibody |
12654-100ul |
SAB |
100ul |
EUR 252 |
VHL (Phospho-Ser68) Antibody |
12654-50ul |
SAB |
50ul |
EUR 187 |
Phospho-VHL (S68) Antibody |
1-CSB-PA060066 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-VHL (S68). Recognizes Phospho-VHL (S68) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
VHL Blocking Peptide |
AF6292-BP |
Affbiotech |
1mg |
EUR 195 |
VHL cloning plasmid |
CSB-CL025852HU-10ug |
Cusabio |
10ug |
EUR 255 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggcc
- Show more
|
Description: A cloning plasmid for the VHL gene. |
VHL Rabbit pAb |
A0377-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A0377-200ul |
Abclonal |
200 ul |
EUR 459 |
VHL Rabbit pAb |
A0377-20ul |
Abclonal |
20 ul |
EUR 183 |
VHL Rabbit pAb |
A0377-50ul |
Abclonal |
50 ul |
EUR 223 |
VHL Rabbit pAb |
A11240-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A11240-200ul |
Abclonal |
200 ul |
EUR 459 |
VHL Rabbit pAb |
A11240-20ul |
Abclonal |
20 ul |
EUR 183 |
VHL Rabbit pAb |
A11240-50ul |
Abclonal |
50 ul |
EUR 223 |
VHL Mouse mAb |
A11872-100ul |
Abclonal |
100 ul |
Ask for price |
VHL Mouse mAb |
A11872-200ul |
Abclonal |
200 ul |
Ask for price |
VHL Mouse mAb |
A11872-20ul |
Abclonal |
20 ul |
Ask for price |
VHL Mouse mAb |
A11872-50ul |
Abclonal |
50 ul |
EUR 265 |
VHL Rabbit pAb |
A16287-100ul |
Abclonal |
100 ul |
EUR 308 |
VHL Rabbit pAb |
A16287-200ul |
Abclonal |
200 ul |
EUR 459 |
SirT3 suppresses hypoxia inducible issue 1α and tumor development by inhibiting mitochondrial ROS manufacturing.
- The position of oncoproteins and tumor suppressor proteins in selling the malignant transformation of mammalian cells by affecting properties reminiscent of proliferative signalling, cell cycle regulation and altered adhesion is effectively established.
Taq DNA Polymerase (Recombinant)
- Chemical compounds, viruses and radiation are additionally typically accepted as brokers that generally induce mutations within the genes encoding these most cancers-causing proteins, thereby giving rise to most cancers. Nevertheless, more moderen proof signifies the significance of two advertditional key components imposed on proliferating cells which can be concerned in transformation to malignancy and these are hypoxia and/or aggravating circumstances of nutrient deprivation (e.g. lack of glucose).
- These two further triggers can provoke and promote the method of malignant transformation when a low share of cells overcome and escape mobile senescence. It’s turning into obvious that hypoxia causes the progressive elevation in mitochondrial ROS production (continual ROS) which over time results in stabilization of cells through elevated HIF-2alpha expression, enabling cells to outlive with sustained ranges of elevated ROS.
Recombination Signal Binding Protein For Immunoglobulin Kappa J Region (RBPJ) Antibody
- In cells below hypoxia and/or low glucose, DNA mismatch restore processes are repressed by HIF-2alpha and so they frequently accumulate mitochondrial ROS-induced oxidative DNA injury and rising numbers of mutations driving the malignant transformation course of.
- Latest proof additionally signifies that the ensuing mutated most cancers-causing proteins suggestions to amplify the method by immediately affecting mitochondrial operate in combinatorial ways in which intersect to play a serious position in selling a vicious spiral of malignant cell transformation.
- Consequently, many malignant course ofes contain intervals of elevated mitochondrial ROS manufacturing when a number of cells survive the extra frequent technique of oxidative injury induced cell senescence and demise. The few cells escaping elimination emerge with oncogenic mutations and survive to change into immortalized tumors.
- This evaluation focuses on evidence highlighting the position of mitochondria as drivers of elevated ROS manufacturing throughout malignant transformation and therefore, their potential as targets for most cancers remedy. The evaluation is organized into 5 fundamental sections regarding totally different features of “mitochondrial malignancy”.
- The primary considerations the features of mitochondrial ROS and its significance as a pacesetter for cell development versus senescence and demise. The second considers the obtainable proof that mobile stress within the type of hypoxic and/or hypoglycaemic conditions signify two of the main triggering occasions for most cancers and the way oncoproteins reinforce this course of by altering gene expression to deliver a couple of frequent set of modifications in mitochondrial operate and exercise in most cancers cells.
- The third part presents proof that oncoproteins and tumor suppressor proteins bodily localize to the mitochondria in most cancers cells the place they immediately regulate malignant mitochondrial packages, together with apoptosis.
- The fourth part covers frequent mutational modifications within the mitochondrial genome as they relate to malignancy and the connection to the opposite three areas. The final part considerations the relevance of those findings, their significance and significance for novel focused approaches to anti–most cancers remedy and selective triggering in most cancers cells of the mitochondrial apoptotic pathway.
Product not found
quotation: istanbul escort
No Comment